EST 457648 is a singleton


Sequence

>457648 (1 EST) Length=209 TTACCCAAGTTTNAGAAATTATAGTTATCTATGTAGATTCTCTAATCAGAGTGCTTCATCAACTTGTCTATGATCGAGCA TACTGGTCGCTAATAGCAATTTACCTGTTGGATCGCTATCTTATAACCAATAAAGAAGTGGTATCATATCACAGAGGAAT GCTCGAAGTGCATGCTATGCGAACTATATGTGCAAATACTGATCGTACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 457648: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4576481193285N52119KJ4SLB183T3JHU93SL-BmL4 (JHU)


Date: 6:19:39 on Fri 24 Nov 117.