EST 457649 is a singleton


Sequence

>457649 (1 EST) Length=223 CCCNNGTTGNNGNCTTGTNCNTTGTTCTNAATAGAGCTAAGGTTAGATAGCATCGTGCACTTACTAAAGAGGAGAAATCG GAACCAAGAATTACGATCGTGCTATCGACGACTTATTTCGAAGATGATGATTGCGATCCATGTGGAATAATTCGCAATCT GGACGTCGCATATGAGTTGCGAATCTCGAGATATTCTAGCTGAGATGATATTCTAGCTGAGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 457649: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4576491193286N52120KJ4SLB191T3JHU93SL-BmL4 (JHU)


Date: 18:58:36 on Sun 19 Nov 117.