EST 457652 is a singleton


Sequence

>457652 (1 EST) Length=135 GGCTGTCTATGGCTAAGGCTATGCACTACTCTAAAGAGAGAAATGCAACCAAGAATAGATCCTCGCCTATGTCAGATATA GTTGCACCATTAGTTATCCGAATACTAGTTAGGATATAGCATCACGTACGTGGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 457652: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4576521193289N52123KJ4SLB242T3JHU93SL-BmL4 (JHU)


Date: 21:34:9 on Fri 24 Nov 117.