EST 457653 is a singleton


Sequence

>457653 (1 EST) Length=238 ATTACCCAAGTTTGAGAATGCACAACTGAATGGNTCGAAGAGTTGTATGCACGCTGTCGCATATTGGCGACTGTCAGAAA GTGTGCGCTCAGAAAGACCATATGTGCCACAGACCATCGTGCTCATACTGTACCGACATATGAAACTTGCATCTTGCTCA ACTAATGCATTATCTATCAGTAGTACTGATCAGGCGTCATCCTTGACTTAACTTCGGTAACTACAAGAACCGTAATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 457653: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4576531193290N52124KJ4SLB244T3JHU93SL-BmL4 (JHU)


Date: 22:7:11 on Sat 18 Nov 117.