EST 457656 is a singleton


Sequence

>457656 (1 EST) Length=220 CCCAAGTTTGNGAAATGGAGTATTNGATGTGGATGCTTTAGACAAGTGCTGCTCTGCTTGCTTCTGTCGGCTCTGTCGAC TGCAATTTCTGTTGGTGCTGGCTTATAACAGTGTAATATCCGGGGATGTCGGATGCACAATTTCTGTTGGTCTCTTATAC AAGTGGTAATAATCCGGATGTCGGATGCTCTTGTGCAATTGTGCGACGGTGCTACCGTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 457656: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4576561193293N52127KJ4SLB247T3JHU93SL-BmL4 (JHU)


Date: 8:31:3 on Wed 22 Nov 117.