EST 457661 is a singleton


Sequence

>457661 (1 EST) Length=114 TAGTTCATTTGATGGTAAGTGGTACATACAATGAAGACTAATGTATCTACGACGATGTATAGTGTGGAGAGATTGCTAGA CATGTGTATTACGTGTGTGCAGTATACACGATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 457661: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4576611193298N52132KJ4SLB262T3JHU93SL-BmL4 (JHU)


Date: 16:36:6 on Sat 18 Nov 117.