EST 457662 is a singleton


Sequence

>457662 (1 EST) Length=146 AGAAAGTGCAGTAGAGTCGATGGTTATGATGTAAATGGGTCAATAGGATAGCACGGTGATACTGATCTCGACAGCAGCAT CGCGTCGTTTGTCAATCTGCACTCAGTGTCATGAGCATTGTGATAGCGCTGTACCATCTTTAGATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 457662: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4576621193299N52133KJ4SLB266T3JHU93SL-BmL4 (JHU)


Date: 12:44:44 on Tue 21 Nov 117.