EST 462172 is a singleton


Sequence

>462172 (1 EST) Length=182 CCGGCCAGTATTAGCAGTGAGATTGACCGAGGTCTTAGGTCTGGAACTGGATGTAATCCCACCTAACTGGTCTCAATCAC TGATTGTACCAGTCTATAAGAAGGATAAAAGTCCTCTTACGACAATCAGGGGATTTAAATCGACAATTGAATCTTTGTGC TAATGTGGTATGGAAACTCGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 462172: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4621721196839L76101SCMRAP0186tcz2/KS adult worm mini-library


Date: 4:11:5 on Wed 22 Nov 117.