EST 462176 is a singleton


Sequence

>462176 (1 EST) Length=242 ATAGACTTGGTGTAATAGGACATCTTATATTAGCTNGCTCTATGTAGAGAAATTGTATTTCCAGGATTTATTGAGGTAGA CGTTGACTTCCAACAACAATNTTTTCCTGACGAACATTGACAAGACTTATTATACACCTGGGAATGTTGATTTAAACTGG AGATCTGAGTTGAGGCTCCTGAATTTGTGTTTGCATTCAGTCGACGGAATTTCTCTCGAAGTTCTGATTCATTAGCTCGC CA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 462176: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4621761196843L76105SCMRAP0190tcz2/KS adult worm mini-library


Date: 12:50:54 on Sun 19 Nov 117.