EST 462178 is a singleton


Sequence

>462178 (1 EST) Length=293 AGGNTTTGATAGGTAAACCAGGAGATGCAGCGTGNTCCTAGTTCAAGAAACTTGAGCACGACCCTTAGAAACCTTTAGGA GCACCGAGTTGNTGCGCAGTATCACATGATTCGAACTTGGAAACAGCTCATGGNGATGAAAGGTTAACAGCCGCATCAAA TAAATTTGGAGAAACAGGTGGACCGCAGGACCAAGCCGGGCTGATATTGGNGTGCTAGGTAAGCTTGCGGGCAGACGTTC CACTACCTCCTGCACTAGGCCCTACAGCAACGCAACAAAGGCTTGGCCTGAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 462178: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4621781196845L76107SCMRAP0192C2/S1 day seven schistosomula mini-library


Date: 21:33:49 on Fri 24 Nov 117.