EST 462179 is a singleton


Sequence

>462179 (1 EST) Length=98 AGGTACAATCAGATACATCGAGGTGGCTGGGTAATATATGATGAAAAGAATGAACATTATTCAGATGTCGATTTCTGAAC TACCAACATCTAACTGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 462179: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4621791196846L76108SCMRAP0193C2/S1 day seven schistosomula mini-library


Date: 12:44:56 on Fri 17 Nov 117.