EST 462181 is a singleton


Sequence

>462181 (1 EST) Length=163 GTAACTTAACATTGGATTAGGACATGAAACTTTTCAAATAATGATGATGNAATAATTACTTACTGTGACGAAACATGAAA TTGTCCTTTTGTTTATGACGGTGGCCTTATTAGTACGTCACCTCATTTGTTATTTATTGTTGAATTCCATTTATAATGCA ACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 462181: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4621811196848L76110SCMRAP0195C2/S1 day seven schistosomula mini-library


Date: 5:55:36 on Sun 19 Nov 117.