EST 462182 is a singleton


Sequence

>462182 (1 EST) Length=138 GTCAGNNTAAGTAAAGNTCTGNTGAGATCGNNTGGGTGCTTGCTGGCAATTCCGNGTAAATGCTTCCCTCCAAATTCCTT GCGGTAGTTATGCGCTGAACCGGGAATTTGTATCGCTGTGCACCATGCCAATTTGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 462182: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4621821196849L76111SCMRAP0196C2/S1 day seven schistosomula mini-library


Date: 23:35:24 on Fri 17 Nov 117.