EST 462184 is a singleton


Sequence

>462184 (1 EST) Length=159 AGGAGTAAGGATCCCCTAGGACGTTAATANGGCCAGCGTCATATGACGNGACNNNATTTAGTTCAAGGTCCGAATTCTTC AATTCTCTTTAAGACCGCTTGTACATGCTTGACGTGACCTGTTTCTGTCTGGCTGTACACAACTACAACGCCATACACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 462184: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4621841196851L76113SCMRAP0198C2/S1 day seven schistosomula mini-library


Date: 4:50:30 on Sat 25 Nov 117.