EST 462191 is a singleton


Sequence

>462191 (1 EST) Length=81 GTGGATGTTGTCTTTTGCTTTCGGTAGTGAATGTAAGTATATTATGTGGGTTTCTGTGTCGTAGTCTCACGTTTTATATC C


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 462191: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4621911196858L76120SCMRAP0205C2/S1 day seven schistosomula mini-library


Date: 7:28:43 on Sun 19 Nov 117.