EST 462199 is a singleton


Sequence

>462199 (1 EST) Length=105 TTTGGGTTTCCTGGAACGTNTCCNAGAGGTNTAGCATCATATAAGTNTCACTTGTACAAGTAAACGNCTTGATCAGATAC AGTATATAGCCATTTCTCTTCCCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 462199: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4621991196866L76128SCMRAP0222G2/KS adult worm mini-library


Date: 0:45:13 on Fri 24 Nov 117.