EST 462202 is a singleton


Sequence

>462202 (1 EST) Length=83 TCCATGCGTTTATAACATTGGCGACGGTGATTAAACGATCTACGTTTACGGATTCAGTTAAAGGGTAAACTTTTGTATTC AAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 462202: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4622021196869L76131SCMRAP0225G2/KS adult worm mini-library


Date: 14:53:29 on Wed 22 Nov 117.