EST 480959 is a singleton


Sequence

>480959 (1 EST) Length=425 TGGTGTCCAACTCGATGGCTCGTACAAAGCAAACGGCTCGCAAATCGACAGGTGGTAAAGCACCACGGAAACAATTAGCA ACAAAAGCGGCAAGAAAATCAGCTCCGGCAACCGGTGGTGTGAAAAAGCCGCATCGTTATCGTCCTGGTACTGTNGNACT GNGTGAGATTCGACGTTATCAGAAGTCTACCGAACTACTTATCCGCAAACTGCCGTTCCAGCGATTGGCGGTGCGTAATT GGCAGGAATTGTGGATTGGTATCGATTAGGCGATATGCTGCTAATGTCGGTGTGGTGATGGATATGTGCAGTTGGACTGA GTCGGCGTNTACTTGGAGTGATNTGNNTGTGCAACTTGCTGTNACTNGTTAGGNCTNTTGCAAATNACGNTTGTGAGGNA TAAGCTCGATATCTAGTGACGATGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 480959: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4809591236196N74797RRAMCA1068SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 18:8:39 on Fri 17 Nov 117.