EST 480973 is a singleton


Sequence

>480973 (1 EST) Length=542 GAGCTAGATGACATCTATTTCACCCGTTCAACTACCAAATGAGTCACAGTGGCGATCTGAACGATCTGATAGATCCGAAT CACGAGCATCTAGCCGATATGTGCCACTTGATCATAGTGGTACTATACATAATACATTGAACACAATGGTTGATAGGGTG AATGCAACAACAGAATTGATCCAACGGAAGCAAAATGAATATGTTATGGGAAGAAAGTCGTTTCAAACGGAAATGGAAGT GAGTGGAAGAATTTCGGTGGAACCAACCGATAATATCTTACGGCTTAAATCTGTAAGCACTGAAGATATGCAAAAGGAAC TTACTAAGCTTAAAGGCGATCAAAAGCAAAATGCTGTAACGGACACTTNGGCTGCATTAGTGTATGATATTGATGCTACC NCTGAAGTACTACGACGTGGTTCAGTGAAAAAGAAGCAACCCACTGGAGAGGAAGTAATCACTGGATACAACTTACGTAT TACACCTGGACCCGGAAGAAGAATACCTNTTCCCATCACCAAAACAGGACCATGCAACAGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 480973: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4809731236210N74811RRAMCA1082SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 21:34:19 on Fri 24 Nov 117.