EST 480974 is a singleton


Sequence

>480974 (1 EST) Length=483 CGGCACGAGTGCTAGTGGTTTGGTTTCTTCTAGCTGGCTTACGCCAGGTAGTAAATAGTCGATTTGGTCTACTTGGTGCT TCATTATATATGGAATGTACACATCATTTACGATGTTCAGAAGCAGATCGAATTCGTTGGTTTGAGTTACGTGAGCATGT CCATAATTTGATTGAATTAGGTAATATTGCACGAGAAGATGGTTACATTATTGAAAAAACCAAACTTCGTCATTCATTAC GATATCGTGATTATTTATGTGCTGAATATCGAACAAGTGGCTATTTACTTTATAATGATAGCAGTTATCATTTGCAAGTT GCATGCATGTGGGTAGGCGGTGAAATGAATGCAACTTGTGGACTGATACCATCAACTGATAAGCCATTCGGATATCATGA ACCACAGGAATGGCGTCGAATGCTTTTGGGTGTTCATCTTAATTAGATGGAAAGATAAAAGCTATCATAGATATAATATA TTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 480974: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4809741236211N74812RRAMCA1083SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 22:6:58 on Sat 18 Nov 117.