EST 480976 is a singleton


Sequence

>480976 (1 EST) Length=563 CTAATATCAGATATCGTTTTATTTTACTGATGATATTATGGATCACAAGTATGATCCGGAAGACATACCGGATAATGCCA AAGAATGGAATAATTATTGGAAGATTCCAGAACAACGGAATGAGTGTAACGATCAAGGAAGAAACAAAATGACCAATGGT CANGCAATGAACACTAAATGTGACAATGAATGCGATCAAAATAAATCAAAAAATTTCGATAGCAAAAAGAAAGGATTAAA ATTTGAAATTAATACAAATACTGGAAATGCAATTACTGAAAAGCAAGAAGAATGCAACGATGGCAAACAATTTGAAAGTA TTGAATGGAACAAAAATTTGCAAATCCCGGGATTACTGATAAATATCTCGAGGAAAATGCACATTAGCATTATCATCATT CCAGATATTATCAGATACTTTNCAACAGTATTACAAGCAATGTTGTGATGCATTTCATATTTGGCACAATGATTTGGCAA TTGGAACAATCGAGCAATGTGAATGCAATTTCGCTAATTAACATCGAGCAGGTAATCATTCAAATATGGAACACTGTTAA CAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 480976: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4809761236213N74814RRAMCA1085SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 15:1:13 on Fri 24 Nov 117.