EST 480991 is a singleton


Sequence

>480991 (1 EST) Length=196 TGTTGTAGTTCTAGGTAAATTTAATATTTACTAGTTAAAGATTGTACGATAATTCATGTAATAAATCCTTGTAAATTGTA ATCTATGTGGTTGTGTTTGGTTTTATATTTATATCTTTCCATTTTTTTCCTCTCCTAATGCTATAAATATTTGGTCTTTT TTTTTGGGAAACTATTGTAANTAAATTTCCTNGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 480991: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4809911236228N74829RRAMCA1100SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 4:8:13 on Thu 23 Nov 117.