EST 481190 is a singleton


Sequence

>481190 (1 EST) Length=412 TCTTGATCGTCCTGTTGGAAAAACCAGCTTTCGATGGGTATACCGTTATCGATTTGATATGCAAATGATTGCAAGGAATT GTCGATAATTATTGTTTNGGACAGATCCCTACCCAAAATGGATCTCAAGCAGCTTACCAAAAGTTTATCAGCATAAACAC GTTTACTTGCTGTGAATAAGATGATTTCAAATGAGCGCGACAACCGCNCCAAAAATTCTTGCAAATGTGGCCGAACACGA ACTCTCCAGAGCGATGTATCTCTAGCAATTAAAAAGTATGGTATTTATCAATATGTGGATATGAATCGACTAAACAAATA AAAAAACGAGGAGTAACAAAACGTTATCGTCCTTNGTGCGGATAATATCAACGATACACGCGGGNTTCAATATTCAAGAA TAGTAGCACAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 481190: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4811901237160N74851SW3ICA1418SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 7:21:36 on Mon 20 Nov 117.