EST 481194 is a singleton


Sequence

>481194 (1 EST) Length=331 CTGGTCTTCCCGGTTGAAGTCGTCGGCAAGCGTATGCGCGTCAAGCTGGACGGATCGCAGCTGATCAAGGTGCACCTGGA CAAGAACCAGCAGACCACCATTGAACACAAGGTCGACACCTTCACGTCAGTGTACAAGAAGCTGACCGGACGTGACGTTA CGTTCGANTTCCCGGAGCCCTACCTATANACTATTACAACCAATAGTTGNTAGAAATTATTCTAATAAGTGAGCGCGCGC GGAAGGTTGGTGAAACTGAAGAAAAAAAACTATGTACGGAACTAGGGTGTGCATAAAACATCTNTGTGCTGCATCGCCCC GCCCCCCTTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 481194: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4811941237164N74855SW3ICA1423SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 3:48:48 on Sat 18 Nov 117.