EST 481199 is a singleton


Sequence

>481199 (1 EST) Length=240 TTGAGGTTGTAAGTTTGGTAATCACTATTCTCTTGAATTTTAACGAAATTGGATGAGAAAGAAATAAAAGTTGGAACAAA TTTGGGNAAAACAAAACGAAGAAAAAAAAGGAAAGAAAAAANGATGTCATCACGATTGCAACATGTAGTTATCAATGATA ACCCGGAAACTTTAGCAATATCACAATTTCACACTAATTATTGTCCAAAAGTNACAATANCACTGACAACANCACCANCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 481199: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4811991237169N74860SW3ICA1438SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 23:35:12 on Fri 17 Nov 117.