EST 495862 is a singleton


Sequence

>495862 (1 EST) Length=198 TTACCCAAGTTTGAGGAATAATTTTGAAGTAGCTTAATAGATGGGGGCATGCCTTTGCAAAGGAAACGACTCAGTCCTTC AGGAGCTATGGAAGCGGAGAACGACCTTCCATATAAGCATATAGGTAAGAGTCATGCAGGTATGACGCTGCACAGTAGCA GAACTCTGCATCCGAGCCATGTACTGCTGATCAGACAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 495862: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4958621442853N89523KJ4SLB179T3JHU93SL-BmL4 (JHU)


Date: 21:51:37 on Mon 20 Nov 117.