EST 495865 is a singleton


Sequence

>495865 (1 EST) Length=155 TTGAGTAGGAAGTTGGTAAGGACACTTGAATGGCTTTTGAATATNAGGAGGAATTGGATGAGCTGGTTAGCAAGATATCG TATCAGATGGATCGGTTCAATACGATAGATAGATGACGAGATCGTACTAGAACTATAGAATCCGATGGCCTTATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 495865: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4958651442856N89526KJ4SLB202T3JHU93SL-BmL4 (JHU)


Date: 19:11:50 on Thu 23 Nov 117.