EST 495866 is a singleton


Sequence

>495866 (1 EST) Length=133 GTAATCTTATCTGTATATTTGGTTACTGTTATCGTATAGGTTCTCGAATATTTTGGATTTTACATGGTAGTGTTCTTTTT TATTGTCGTGACTTAGGATTATCTATTGAGTTGACCACGTAAGGTTAGTATAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 495866: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4958661442857N89527KJ4SLB206T3JHU93SL-BmL4 (JHU)


Date: 8:41:8 on Fri 24 Nov 117.