EST 495867 is a singleton


Sequence

>495867 (1 EST) Length=173 TTACCCAAGTTTGAGAATGNGTATTGATGCTTTACAGTGCTGCTGACTTGCTTGGATCGGCTCTGTCGTATGATCGAGCT CTGTGTATAGCAATTTCTGTTGGTCTGCTTTATAACCAAGATGGAATATCAAGGAGATATCAAGGAGGAATTCGAGATCT CTATGTACATTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 495867: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4958671442858N89528KJ4SLB207T3JHU93SL-BmL4 (JHU)


Date: 8:19:8 on Wed 22 Nov 117.