EST 495868 is a singleton


Sequence

>495868 (1 EST) Length=190 AATTACCCAAGTTTGAGGGNNAAATAAAAAGAAGCAAAATNTTCGGGGTGGNTNAGCTAGGAAAGGGGTAGGCACACTTC ATGCTCNTNACGATATAGGAGGAATGATCGAGTGNTACAAGATGGTGTCATACAGATAGATGCAGNGTAGCAATATAGAG CTGGTTATCGGACTGAATCGATCCAAACGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 495868: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4958681442859N89529KJ4SLB208T3JHU93SL-BmL4 (JHU)


Date: 9:4:22 on Tue 21 Nov 117.