EST 495870 is a singleton


Sequence

>495870 (1 EST) Length=186 TTACCCAAGTTTGAGGTTTGTAAGNAAGAAAATTGATGANNTCCTCATAAGGACACTGCTAGACATAGAGCGAGGGATNC CGTGCAAGNCACCAAGCAAGCACAGCGCTCAGACGCAAGATGATTAAACAGACCTAAGGACTCTATCCGAATCTAGTAGA TGCAGTCTACTGCTCTAGCCATCAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 495870: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4958701442861N89531KJ4SLB210T3JHU93SL-BmL4 (JHU)


Date: 13:52:39 on Mon 20 Nov 117.