EST 495872 is a singleton


Sequence

>495872 (1 EST) Length=195 TTACCCAAGTTTGAGTACAAAGAATCTTAAACATTTGGCATTTGTTAATGATACACTGATGCATCATGGGGGATTCATCC GACTTTAGCGATTTTCAAGTGATTTGAAAGAACCGAGAAGAGATCATCGTATAACTCGCAACGCAAATTGATCCGTTATC GTGCTCGTCACTTACTGATTATCTTTAGTTCAGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 495872: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4958721442863N89533KJ4SLB217T3JHU93SL-BmL4 (JHU)


Date: 19:33:43 on Sun 19 Nov 117.