EST 495873 is a singleton


Sequence

>495873 (1 EST) Length=191 CCCAAGTTTGAGGGACATCTCTACTCGATTTACCTTATCTAAGAACTTCGCTCTCTTCTTCTTATGATTGCTAGGTACGA GAAGTAGCTTAAAAATAGAGACCAGTGGCCTAAAAGCGTATGCTCGGACTGAACGGCTCAGCAGGTCAGCGAGTAGTGAT ATGTGCAGTCGGGAGAGCTGATATCTTGATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 495873: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4958731442864N89534KJ4SLB220T3JHU93SL-BmL4 (JHU)


Date: 8:46:27 on Fri 24 Nov 117.