EST 495879 is a singleton


Sequence

>495879 (1 EST) Length=191 GAGTCTNNNTAATTACCCAAGTTTNAGTAATGACGAAGGGTACGTCATCTATGTTGGTAAGCGATCGCATAATAAGACCG ATACGTTGTGCCTCGGTATGCGGTGCCTGAGCATCTTATCNTATACAAACTCAAGTGTGCGTATATGTGTACCATCTCTC GTGACGTCGAGTTACATTGCAGAAGTCAAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 495879: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4958791442870N89540KJ4SLB236T3JHU93SL-BmL4 (JHU)


Date: 11:55:5 on Thu 23 Nov 117.