EST 495880 is a singleton


Sequence

>495880 (1 EST) Length=217 ATACCCAAGTTTGAGCAGCAGGAATGGTGGTTGCGCGATATGGATCGCGCGAGCATGATGGGGTGGNGGGCGTATGAAAC GCACGAGGAAAAATCCGAGGCAAGAAAATCGCCAAATATGATGATCACGCACCCCAAAGAATGGTGGCAGTCGCCGAAAA TGCACAAGAATGGATACCGGCAAGTCCGATATGTACACCAGATCGGATATACATGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 495880: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4958801442871N89541KJ4SLB237T3JHU93SL-BmL4 (JHU)


Date: 19:11:54 on Wed 22 Nov 117.