EST 495881 is a singleton


Sequence

>495881 (1 EST) Length=196 CCCAAGTTTAAGAGTGGGTTGGGNCGGTTGNNGGAGGNNTGAGAGATGAGTTTGGNNNNTGNGTGGAGAGCAGATGGTGC GATCGGGGAAAGACGGAACGAACGGACACGGTGCCGNACGGCTGGAGTTTCGGAGAGCAAGAGTTGAGCCGGGGAGAACA AGCTGGTGGTACCGGATGCGATCCGGAATGTGAGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 495881: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4958811442872N89542KJ4SLB241T3JHU93SL-BmL4 (JHU)


Date: 19:23:24 on Wed 22 Nov 117.