EST 495885 is a singleton


Sequence

>495885 (1 EST) Length=191 AATTACCCAAGTTTNAGGTANAAATTTTNTGAACAAGTTGNAGTGTGNCTTGCAACGATNTGTTGATTCTTCAAGGATGN ATTCTCAGATGGATCGAGCTTGGCGNCGNACTCGTTCCCAATGAAGTTAGTTAGATGATTGATTGGAAGTTCTTGGAGGC CAGTAGTAAGGAGCGATAAGGAAGAAGACGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 495885: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4958851442876N89546KJ4SLB269T3JHU93SL-BmL4 (JHU)


Date: 14:31:29 on Fri 17 Nov 117.