EST 501440 is a singleton


Sequence

>501440 (1 EST) Length=470 TTTGACGTCACAGAAAATCGCAATCAACCATTATCATCGCCCATCTATACGGTGTCTGGTGCAGAAAATGCAGTTACACC AACTCCATTAAGAGGAACATTAGGATTAGCACCATCACCTCTTGGATCATATATCATTCCACCTTGGGATTCGGTATCAT CTGCAACAACCAGAAGTATTAGTAATGAAACATCCGTATCAGTTAACAAAAATTGGCGTCCAGCTCAACAGCTTCCAATA GGATCTGCACATAATGATCCGGTACTCATCTACTCAAATGTNCCTATTACTACTGCTGCTGCTAGCGATGGTACTGCTGG TGCTATCGGTGGTTGTGCTATCGGTGGTGGTGCTATTGGCGATGGGGCTACTGGTTGGCGGGAGGGGGTGACAGGGAAGG TCAAGGCGTTTTCAAAAGNTNTCCACAATTGGATCAAGTGGAATTCGGACAAATTGGAGGCAAGAATCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 501440: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5014401266961N94680RRAMCA1150SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 16:52:8 on Wed 22 Nov 117.