EST 501452 is a singleton


Sequence

>501452 (1 EST) Length=477 TGAATTTGATGTCTTTGTCTGGCAATTGCANGGGCTTTTTGTTTTAGTTTGGCAAAGANAAAAAAANCNTTGGGGGGGGG CGTTAGGGAGAAACTAAAGGTAAGGAGATCGAGTTTAGGAACGCTGTNAGAAATAAAGAGGGGGAAATTGATGCGGCCGG AAGGTNCAACTTCTGNTAACGCCAATNCANCTCGACCAAATGTTGTGTTCCAANTTNTCCTCCGNAAAAGAAGGGGGAAG GGTTTAGGACGCATTTGGGGAAAATTTCCCTGGATTGATTTAGGGGGCAATGAGCGAGGNGCCGATANAATAAATACAGT TCCGGGAAATCTCGTTTGGANGGTCCANAAATCAATAATTCTCTTTTGGNTCTCAAAGGGTGTTTTTAGAGCAATGGGTC GGGAATTCAGCCATTTTCCATTTCGGGCCTCCCAAATTCAACGCTGGCCCTCCCGGGATAGGTTCCATTGGTTCCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 501452: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5014521266973N94692RRAMCA1162SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 7:31:9 on Sun 19 Nov 117.