EST 501454 is a singleton


Sequence

>501454 (1 EST) Length=438 TTTGAGGATATAATGCAGATATGGAAGTTGGTAGTTGTGTGATTTGTACACAAAATCTATGCCTTAGCAATGTTTCGTCT CTACCGTGTGGACACACATTCCATTATAACTGTATCCGGCGTTGGCTTGCGCAATCTCAACAGTGTCCTACCTGTCGTGC AGCGTCAACACCTATGAATATCGTGAAACGTTTATATTTTGCTAATTGTACCGATAAGGCTGTGAATGATAGCAAAACTN CAGTAACTGATTCTGATACGAAATCCAAAAAGATGGATAAATGTGATGTCGGCCATCGCNGTGCTGGTAATGATGAAAAT GGAACAATACAAGTGGTGATCCTGAAGATGAAGAAGTGGATAGNGATTNCACAGGGTCGGTGACGANGATCAAGTATGAG TNGTTCGGAANGTGAAGATTTGGCTTATCAAGACCAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 501454: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5014541266975N94694RRAMCA1166SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 11:34:43 on Wed 22 Nov 117.