EST 501474 is a singleton


Sequence

>501474 (1 EST) Length=277 CGTCGTTGCAATAACCGGTCCATATCTAGCTTTAGCGTTGAAAAATGCCGTAGCAGCAATGTAACCGCCCTTTGTGTTGT ACGTGACAGCCATGCCGACAGGACATTATGACCGAATAGCTCTTCAGGATTCTCCAGCTGTACAGGCACAACACATGGAC TTATACGTCCTGCATTCAACAAAATTTCTGCAAATTAAATTCAAAAATTACTCAGTTCAACGAACTGCCGGTCTTTTCCT AATCTATATCTACAAATTCAAATAAACTTGCAATCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 501474: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5014741266995N94650RRAMCA1195SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 12:14:18 on Fri 17 Nov 117.