EST 501481 is a singleton


Sequence

>501481 (1 EST) Length=379 CGGAGCGTGTCGTTGATGTAGTAGAAGAAGTACAGGACTGGGAGAGCCACATTATTCTCAGGTTGCCGGACATTATAGTT GCAATAGTGAGGAAGATGATTGAGGAATCTGGCGATAGTGATCTCGCTTTGGGCCACCAGCCAGATATGCGAAATGCAAC CATACAATTTCAGCATCAAATCATGTCTGCAAAGTTGCATGATCTACCTTGTATTGTTGANGTGATGGGGAACTATCGAT AGAAAAAAATGTTTACAAAGTCGCTGATGCATCTCAAATTATGATCTGTCCGGATAATTTGCAACCTATCACAGAAACAT CACTTCAGAGTGATACGTCGAAATCGAAACGTGATAGAATNTGGCAGTGGCCTCATGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 501481: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5014811267002N94657RRAMCA1202SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 1:55:58 on Sat 18 Nov 117.