EST 501482 is a singleton


Sequence

>501482 (1 EST) Length=397 CCAAGTTTGAGTTCTGATATTGATCTCAACAATGGGAAGAGAAAAAGTGTTTAATTCTGTTTTTGTAAAAATTTTGGGAT GGAGCAAGTCGAAAATCTGATGGTATGGCGTGGGAAAGGCGACAAGTTTCAAAAAGAAATGCCAGATTGCGATCTAAAAG CGAACGCACGTCACCAACACAGCGACGAAGAATCAAGAAAAATGTGCGATTTTCGGACTGCTTTGATTTGGAACAAGCGG NATACGCTATCAATACGCAAGCGGAAAAGGGCAGTGAAAAATGCACGCATTTANCTGTAAGCAATGGGCCTTGTAGTTCT GCTTCGGAATTGCAGCTACAGAAATATTTTGGGCTACCACCAGAAAATGAACTGAGATGGTTGGTTGGGTGAGCAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 501482: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5014821267003N94658RRAMCA1203SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 14:5:38 on Fri 17 Nov 117.