EST 501484 is a singleton


Sequence

>501484 (1 EST) Length=392 CGATATAATCTGAAAATTNGCAGCTAAAAAATGCAGTAAACTTTAATTNGAAATTACAAAAAAACTTACCAAATTATAAT CTTGAAAAAACTTTNTTATGGTATTTATTTATCCTGGGTAAAATGCTGAGATTTCTTGTTATGTATCTCCAATGATAAGT TACCTTTTTATATCTNACCGTTTCTGATTTTTCTAGGGCTTTATAAAAGAATCACATNNGGTCCGTCTGGCAGGTNTCTC AGGTGTGGGGGNAANATCACTAGGTGCATATGGAGCACATGTNNNACGTGAAGGTGGAAATGCAGATGAACGGCGNCTTC GTGCTNNGGANACCGGAAATCGTCATCATCTGATACATNCAGTAATGCTANTCCTTGCTAATAAGGCACGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 501484: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5014841267005N94660SW3ICA1424SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 22:39:9 on Thu 23 Nov 117.