EST 501490 is a singleton


Sequence

>501490 (1 EST) Length=399 ACGACGCCTCCTGTCTGGCTAAATAGTGATATNGTGAAGCACCTGGAAGCACCTTCAATAAAAGAAAAACCACTGGCTTG GACAGAACTGGAGGCTCGTTTCACTCGCGCGATGCTACAAGTTGCAGATCTTGCCGAGGAAAAGGAACGTCTCCAACATA TTGTCATGCAGNTGGAGACTGAAAATGATACCATCGGTGATTATGTAACATTATATCAACATCANCGGAAAAAAATCAAT GAANGGATGCGNGAAAGAGAGGAAGCTGTAGCAAAATTTTCTTTCGAAAAAGAGCAGACGCAGCAAANGTTAAACGACCT GCAAAAAGTGNNGGATGANTTTACTATCANGGTGATGTTANGACTCTNGGTGATGAAATTGAACAGATGAAACTGAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 501490: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5014901267011N94666SW3ICA1433SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 6:43:48 on Sat 25 Nov 117.