EST 504108 is a singleton


Sequence

>504108 (1 EST) Length=350 AGAAAATATTATATACATAATTTAAGAAATAATATTTATGACAATTCTTTTATGAATATTTTTGATTATATTCATTATAA CATTAATTTACATTTAAAAAATTATAACTTGAAAAATACTCATCAAGTTCTACATAATATATCCATATATATACACAAAA ATAAATGTAATAATATCACACATGANCTTGTTACCAATATATTCTTCTTTTCATTTTTTAAAAACTTTAATAAGTTTTAT ACAAAAAAAGAAGGCAAGGATAAAAATGAAAGTCACGGAAATTTTCCTAATTATGTTAATCAAAAAAATCACAATGNTTT AANTATAAAGNTAACAANTAATTNTCATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 504108: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041081399969N974570583M7gmbPfHB3.1, G. Roman Reddy


Date: 11:50:59 on Thu 23 Nov 117.