EST 504111 is a singleton


Sequence

>504111 (1 EST) Length=350 TATCCATTGAGATGTTCCAAAAAAAAGGTATATTTTTACAATAGTTATGAAAAATTAATATTCTTTGCCAAGTAATTATA TTCATATATCGAAGNAAATATATGTGACCTNGTNGTAATAAATAGAACATTTTCGATCCTTCAAAGATCATCCTTATTTA TTACCTTTTTAATATGCTCTAATTTGGTAAGGAGACTATTAGTAGATGTGTTGCTTAACGTTTTTNTTCTNCTTTTTTCA TCACATGTTTCACTAATATATTTAATATCTGTAATTAAAGTATCGTATAATTTATTAATATCTACATCATTAATTTCTAT AGNATTTTCTACAGACATTGTTATTCCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504111: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041111399972N974600588M3gmbPfHB3.1, G. Roman Reddy


Date: 7:25:19 on Sun 19 Nov 117.