EST 504118 is a singleton


Sequence

>504118 (1 EST) Length=334 TTATTTTTCCTTTGTTTTTTACAGTGGTAAGGATATATTTGAAATTTTTCAAAATATGCAAAAGAAGCTAACATTTCCAA AATACCGTAAAATAGATAAGGACTTAAAGAATTTACTCAGGTATAAATAAAAATCATAATTTAATTAATTTCATTAATTT ATTCTTTATTTAAAAAAAAAAAAAAATGCTTTTTTTTGCTGTTTTTTTCTACATATTTTTAGAAAGCTATTAAAGGNAAA CCAAGATGANAGAATGCAATTCAAAAAAATTAAAAGGCATAAATGGTTTTTAAATANTANTTGGATATCCANTATAAATA ATATATATNTATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 504118: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041181399979N974670594M3gmbPfHB3.1, G. Roman Reddy


Date: 7:0:1 on Mon 20 Nov 117.