EST 504121 is a singleton


Sequence

>504121 (1 EST) Length=341 ATTTTATTGAAAAAGTAAAAATTTAAAATGGAGAGCCTAAACATTCCAAAGAATGTNAGCATGGATTTATTAGAACCATT TATAACAATTTGTGTTATATTTATTTGTTTATATATGATTATNAGTATTGAAAGTCCTGTATATNATTTGATAAGAAGTT TTCTTTTTAAATCAAAAATATTTCTTCATGAGATAAAAGATATATTTNCAAAANTTAATTATTTTGCTCTAATATTTNCC TCCTTTTTTTTTGTTTCATATTACATTTNGAACATTTTAAATTACAAAAACGTGAAATCTCTTTTTGGTGTTAATNTTTG ATTATNATGNTACTATNTTAN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504121: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041211399982N974700597M3gmbPfHB3.1, G. Roman Reddy


Date: 0:23:38 on Thu 23 Nov 117.