EST 504122 is a singleton


Sequence

>504122 (1 EST) Length=350 TATTTTTTTTTTTTTATAGTATACCTTAAAACTGTCTATGGTATTCCTTAAGAATATTATAAAGTAGATAATAATCGCAA CCAATAATTTGATTTCATAAAATTTTTCATTATTAATTATATAAAANATAAAGAATAATATATGGATATAAATNCTTATT TCAGTACCATGATAAGGATGTAAACTTCTGTCATTATATTGATAGACGCTTAAATAAGGATTCTTTATATAANAGANTAG TAAAAAACCAAATGAAAATATTTCATGCCCACAATGATTATATTTNATATTTAANAACTTTTTAAAAAAGTAAACGNTTA CAAATCCTGATAGTATAATACTTGGCAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 504122: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5041221399983N974710597M7gmbPfHB3.1, G. Roman Reddy


Date: 1:21:37 on Mon 20 Nov 117.